Primer Design and Phylogenetic Analysis of the amFP486 Gene Family in Stylophora pistillata

**

Primer Design and Phylogenetic Analysis of the amFP486 Gene Family in Stylophora pistillata

1. Project Objective and Introduction

Target Organism: Stylophora pistillata (Lace Coral).
Gene/Barcode Region: amFP486 (GFP-like fluorescent protein family).

Introduction: In reef-building corals, fluorescent proteins play a vital role in physiological resilience and photoprotection. My research specifically focuses on the phenotypic divergence between High-GFP and Non-fluorescent larval morphs in S. pistillata. This project aims to analyze the evolutionary relationships between different gene codenig for the same fluorescent protein paralogs within the species and design specific primers for gene expression quantification (RT-qPCR).

Goal: Identify conserved domains for primer design and construct a phylogenetic tree to resolve the relationship between intra-species protein variants.

2. Sequence Collection and Alignment

NCBI Accession Numbers Used:

  • LOC111319708 (S. pistillata GFP-like fluorescent chromoprotein amFP486, mRNA - Target Template)
  • LOC111347142 (S. pistillata GFP-like fluorescent chromoprotein amFP486, mRNA)
  • LOC111346784 (S. pistillata GFP-like fluorescent chromoprotein amFP486, mRNA)
  • LOC111344518 (S. pistillata GFP-like fluorescent chromoprotein amFP486, mRNA)
  • LOC111344517 (S. pistillata GFP-like fluorescent chromoprotein amFP486, mRNA)
  • LOC111342395 (S. pistillata GFP-like fluorescent chromoprotein amFP486, mRNA)
  • DQ206398.1 (S. pistillata GFP-like chromoprotein mRNA, complete cds)
  • AF420592.1 (Acropora tenuis s0366_g7_t1 mRNA for green fluorescent protein, complete cds - Outgroup)

Alignment Parameters:

  • Software: MEGA (Molecular Evolutionary Genetics Analysis)
  • Method: ClustalW
  • Sequence Type: DNA (mRNA/Coding Sequences)

Multiple Sequence Alignment (MSA) Output

image1

Sequence Analysis:

  • Conserved Regions: Identified by the ‘*’ consensus symbols, particularly at the 5’ and 3’ flanking regions. These represent structurally essential motifs of the beta-barrel protein structure.
  • Variable Regions: Significant SNPs were identified in the internal regions. These variations distinguish the different genes codenig for the same protein.

3. Primer Design (NCBI Primer-BLAST)

Primers were optimized for the target sequence LOC111319708 using the following criteria: Product size ;430bp, Tm ~60°C.

image2

Selected Primer Pair Detail:

| Property | Forward Primer | Reverse Primer | | :— | :— | :— | | Sequence (5’->3’) | GTGGCACCGACCTTGAAGTA | GGTTGGTTCTGGTAAGGCGA | | Length | 20 bp | 20 bp | | Melting Temp (Tm) | 59.97°C | 59.96°C | | GC Content | 55% | 55% | | Primer Position | 181-200 | 610-591 |

  • Expected Amplicon Size: 430bp.
  • Specificity: Verified via Primer-BLAST against the Stylophora pistillata taxid; no significant off-target amplification predicted.

4. Phylogenetic Tree Construction

Methodology:

  • Tree-Building Method: Neighbor-Joining (NJ)
  • Substitution Model: Kimura 2-parameter model
  • Test of Phylogeny: Bootstrap method (1000 replicates)
  • Gaps/Missing Data: Pairwise deletion

Final Phylogenetic Tree

image3

Interpretation:

  • Clustering: All S. pistillata fluorescent protein sequences cluster together with high bootstrap support, confirming they are paralogous genes within the same lineage.
  • Evolutionary Context: The tree resolved the separation between the green fluorescent variants and the chromoprotein.
  • Outgroup: Acropora tenuis correctly branches as the outgroup after manual rooting, providing a clear evolutionary direction.

Author: Liel Uziahu
PhD Research Focus: Larval Physiology in Stylophora pistillata Date: May 2026

Written on May 12, 2026